ID: 1145156936_1145156950

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1145156936 1145156950
Species Human (GRCh38) Human (GRCh38)
Location 17:20550171-20550193 17:20550198-20550220
Sequence CCCCCTTCCCCATGGGGACAGTG CTGTAGTTCTAGGGAAATGGGGG
Strand - +
Off-target summary No data {0: 2, 1: 3, 2: 15, 3: 11, 4: 208}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!