ID: 1145190797_1145190803

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1145190797 1145190803
Species Human (GRCh38) Human (GRCh38)
Location 17:20841480-20841502 17:20841503-20841525
Sequence CCTCTATGCCGACATCGACGCCG CCTGGCAGGCCCTGCGCACCAGG
Strand - +
Off-target summary {0: 5, 1: 3, 2: 4, 3: 1, 4: 8} {0: 10, 1: 2, 2: 2, 3: 28, 4: 321}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!