ID: 1145190802_1145190821

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1145190802 1145190821
Species Human (GRCh38) Human (GRCh38)
Location 17:20841503-20841525 17:20841556-20841578
Sequence CCTGGCAGGCCCTGCGCACCAGG GGCACACCCAAGAGGGGACCAGG
Strand - +
Off-target summary {0: 11, 1: 0, 2: 2, 3: 39, 4: 362} {0: 4, 1: 4, 2: 2, 3: 13, 4: 152}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!