ID: 1145190807_1145190817

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1145190807 1145190817
Species Human (GRCh38) Human (GRCh38)
Location 17:20841513-20841535 17:20841548-20841570
Sequence CCTGCGCACCAGGTGAGGGCGAC TCAGCCTGGGCACACCCAAGAGG
Strand - +
Off-target summary {0: 10, 1: 1, 2: 0, 3: 5, 4: 62} {0: 6, 1: 4, 2: 2, 3: 10, 4: 198}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!