ID: 1145190824_1145190835

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1145190824 1145190835
Species Human (GRCh38) Human (GRCh38)
Location 17:20841562-20841584 17:20841575-20841597
Sequence CCCAAGAGGGGACCAGGCCGGGG CAGGCCGGGGGCCGGGGGGCGGG
Strand - +
Off-target summary {0: 2, 1: 9, 2: 2, 3: 25, 4: 185} {0: 2, 1: 5, 2: 25, 3: 176, 4: 1561}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!