ID: 1145193329_1145193340

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1145193329 1145193340
Species Human (GRCh38) Human (GRCh38)
Location 17:20866874-20866896 17:20866921-20866943
Sequence CCTGGGGTGGGAGTGAGTGCCTT TCCAGCTGGCCAGGAATTGCTGG
Strand - +
Off-target summary {0: 8, 1: 1, 2: 14, 3: 79, 4: 1342} {0: 7, 1: 4, 2: 7, 3: 28, 4: 219}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!