|
Left Crispr |
Right Crispr |
| Crispr ID |
1145194385 |
1145194391 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:20876479-20876501
|
17:20876504-20876526
|
| Sequence |
CCTCATGGATGGTATGAGTGTCT |
TAGAAGGGCTGGAGGGAATTAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 4, 2: 6, 3: 81, 4: 511} |
{0: 4, 1: 1, 2: 4, 3: 39, 4: 276} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|