ID: 1145217448_1145217454

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1145217448 1145217454
Species Human (GRCh38) Human (GRCh38)
Location 17:21062529-21062551 17:21062580-21062602
Sequence CCAGCAGGAAGACATAGACAAGA TTATAATCAGTAATGGGAAACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 292} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!