ID: 1145228071_1145228073

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1145228071 1145228073
Species Human (GRCh38) Human (GRCh38)
Location 17:21147828-21147850 17:21147856-21147878
Sequence CCAAAGGAGATGGCAAATCATAA GCTCAGCAACACAACACTGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 53, 4: 266} {0: 1, 1: 0, 2: 2, 3: 13, 4: 136}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!