ID: 1145233239_1145233244

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1145233239 1145233244
Species Human (GRCh38) Human (GRCh38)
Location 17:21190328-21190350 17:21190379-21190401
Sequence CCTTCTAACACCTAAAACAAACT TAATACTTGACATCGAGAACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 243} {0: 1, 1: 0, 2: 0, 3: 1, 4: 57}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!