ID: 1145259985_1145259997

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1145259985 1145259997
Species Human (GRCh38) Human (GRCh38)
Location 17:21348971-21348993 17:21349010-21349032
Sequence CCCACCCCCATGGGCCCCTGCTC TCCCAGTATCCTTTGCCCTCAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 3, 3: 68, 4: 681} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!