ID: 1145266202_1145266212

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1145266202 1145266212
Species Human (GRCh38) Human (GRCh38)
Location 17:21380719-21380741 17:21380743-21380765
Sequence CCATCCAACCTTCCCTTGGACAT TAGGGAAGCAGGCCCAGGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 245} {0: 1, 1: 2, 2: 1, 3: 64, 4: 471}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!