ID: 1145311038_1145311043

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1145311038 1145311043
Species Human (GRCh38) Human (GRCh38)
Location 17:21701191-21701213 17:21701235-21701257
Sequence CCGGGGGTGGGCACATCAGTGGC CTGGCATGGATGCCCTGCTGCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 16, 4: 201} {0: 2, 1: 0, 2: 3, 3: 23, 4: 223}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!