ID: 1145311117_1145311128

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1145311117 1145311128
Species Human (GRCh38) Human (GRCh38)
Location 17:21701552-21701574 17:21701591-21701613
Sequence CCAGCTTGGGGTGTTCAAAGTGG CAGGCCGCATTCTAGGCCCTGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 3, 4: 99} {0: 2, 1: 0, 2: 5, 3: 51, 4: 310}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!