ID: 1145311353_1145311361

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1145311353 1145311361
Species Human (GRCh38) Human (GRCh38)
Location 17:21702685-21702707 17:21702724-21702746
Sequence CCTGGAGCCACCAGCCCAGCCAG GTTCCAGGAGCCGCCCTGCCTGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 12, 3: 85, 4: 692} {0: 1, 1: 1, 2: 1, 3: 26, 4: 244}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!