ID: 1145313388_1145313398

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1145313388 1145313398
Species Human (GRCh38) Human (GRCh38)
Location 17:21713030-21713052 17:21713070-21713092
Sequence CCAGAACATTCATGCTAAGGGAG GAGAACATGGGGCAGGTGACTGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 6, 3: 32, 4: 346}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!