ID: 1145314692_1145314699

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1145314692 1145314699
Species Human (GRCh38) Human (GRCh38)
Location 17:21722682-21722704 17:21722717-21722739
Sequence CCTCATCTTCCATCTCTCAATTC CCTCACTCACCACAGTCATGGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!