ID: 1145314693_1145314700

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1145314693 1145314700
Species Human (GRCh38) Human (GRCh38)
Location 17:21722691-21722713 17:21722718-21722740
Sequence CCATCTCTCAATTCCACATTCTT CTCACTCACCACAGTCATGGGGG
Strand - +
Off-target summary {0: 3, 1: 1, 2: 2, 3: 74, 4: 637} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!