ID: 1145314694_1145314705

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1145314694 1145314705
Species Human (GRCh38) Human (GRCh38)
Location 17:21722704-21722726 17:21722756-21722778
Sequence CCACATTCTTCCTCCTCACTCAC CCTAAGACTCCCCTCTCCCGGGG
Strand - +
Off-target summary {0: 4, 1: 1, 2: 4, 3: 86, 4: 816} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!