ID: 1145316612_1145316622

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1145316612 1145316622
Species Human (GRCh38) Human (GRCh38)
Location 17:21738909-21738931 17:21738941-21738963
Sequence CCACCACCAAGCGCAGAAGCCTG GATACTGGGAAATGACCTGAGGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 1, 3: 16, 4: 166}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!