ID: 1145386080_1145386082

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1145386080 1145386082
Species Human (GRCh38) Human (GRCh38)
Location 17:22412446-22412468 17:22412468-22412490
Sequence CCTGTCACTGGAACACTGGTCTC CTCTGGACAAGTCACCAGTTTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 21, 3: 40, 4: 129} {0: 1, 1: 1, 2: 8, 3: 26, 4: 114}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!