ID: 1145694521_1145694536 |
View in Genome Browser |
Spacer: 25 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1145694521 | 1145694536 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 17:26775728-26775750 | 17:26775776-26775798 |
Sequence | CCCCGCCGCCGCGGCACTGAGGG | CTCCACTGGCGTCCTGGCAAGGG |
Strand | - | + |
Off-target summary | {0: 1, 1: 9, 2: 10, 3: 23, 4: 109} | No data |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |