ID: 1145694528_1145694535

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1145694528 1145694535
Species Human (GRCh38) Human (GRCh38)
Location 17:26775736-26775758 17:26775775-26775797
Sequence CCGCGGCACTGAGGGCGGGAGCG GCTCCACTGGCGTCCTGGCAAGG
Strand - +
Off-target summary {0: 1, 1: 16, 2: 10, 3: 18, 4: 112} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!