ID: 1145722019_1145722031

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1145722019 1145722031
Species Human (GRCh38) Human (GRCh38)
Location 17:27082549-27082571 17:27082594-27082616
Sequence CCTTTCCGACCAGGGGAAATGTC TTGCAGCCTATTCCATGAGGGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!