ID: 1145741837_1145741843

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1145741837 1145741843
Species Human (GRCh38) Human (GRCh38)
Location 17:27281298-27281320 17:27281331-27281353
Sequence CCAACAGGGCTCTATACCTGGCT CCAGCTTCTGGACTGTGAAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 126} {0: 1, 1: 0, 2: 3, 3: 16, 4: 238}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!