ID: 1145749712_1145749719

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1145749712 1145749719
Species Human (GRCh38) Human (GRCh38)
Location 17:27346585-27346607 17:27346624-27346646
Sequence CCTCCAAAGGTTTCAGAAGTGAG CCCTCTCATTTTCCTGCAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 168} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!