ID: 1145761257_1145761271

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1145761257 1145761271
Species Human (GRCh38) Human (GRCh38)
Location 17:27426435-27426457 17:27426487-27426509
Sequence CCTCTCATGCCTACTTTCCCCAC TGGGACATATATTTGCTGGAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 26, 4: 338} {0: 1, 1: 3, 2: 2, 3: 16, 4: 146}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!