|
Left Crispr |
Right Crispr |
| Crispr ID |
1145768677 |
1145768684 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:27477046-27477068
|
17:27477089-27477111
|
| Sequence |
CCTCACCTTTTCAGACCATACAG |
ATGGTATATGTAAAGTGTCATGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 4, 2: 55, 3: 528, 4: 892} |
{0: 1, 1: 0, 2: 70, 3: 1094, 4: 1157} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|