ID: 1145780147_1145780152

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1145780147 1145780152
Species Human (GRCh38) Human (GRCh38)
Location 17:27557382-27557404 17:27557422-27557444
Sequence CCTCTTTCCAGGCAAGAATTAGA GCTGCTGGTGCCCACTGTGGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 18, 4: 211} {0: 1, 1: 0, 2: 3, 3: 45, 4: 315}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!