ID: 1145786052_1145786058

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1145786052 1145786058
Species Human (GRCh38) Human (GRCh38)
Location 17:27594563-27594585 17:27594608-27594630
Sequence CCATACAGTGGTGGTGCCAGAGG GCCCTCCAGGATCCCACTGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 156} {0: 1, 1: 0, 2: 0, 3: 15, 4: 182}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!