ID: 1145825939_1145825944

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1145825939 1145825944
Species Human (GRCh38) Human (GRCh38)
Location 17:27877401-27877423 17:27877451-27877473
Sequence CCACTAAGTGACAGACTGGGATT CCCCCTCCAGCAGGCCACACTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 8, 4: 129} {0: 1, 1: 0, 2: 7, 3: 32, 4: 342}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!