ID: 1145846484_1145846496

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1145846484 1145846496
Species Human (GRCh38) Human (GRCh38)
Location 17:28042573-28042595 17:28042607-28042629
Sequence CCTCCCCCAAATTAAGAATGGAG ACTTGTGGCAGGAATCCTGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 171} {0: 1, 1: 0, 2: 1, 3: 15, 4: 178}
Status Complete

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
11 17:28042573-28042595 CCTCCCCCAAATTAAGAATGGAG - 17:28042607-28042629 ACTTGTGGCAGGAATCCTGGGGG +