ID: 1145879777_1145879782

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1145879777 1145879782
Species Human (GRCh38) Human (GRCh38)
Location 17:28344655-28344677 17:28344668-28344690
Sequence CCGCCCCATTGGCCACCCCATGC CACCCCATGCTGCTGCTGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 246} {0: 1, 1: 3, 2: 7, 3: 68, 4: 443}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!