ID: 1145881034_1145881040

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1145881034 1145881040
Species Human (GRCh38) Human (GRCh38)
Location 17:28352880-28352902 17:28352900-28352922
Sequence CCATTCCACCTCCCCTTCTTGAG GAGAGAGATTACCTTTTGTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 52, 4: 512} {0: 1, 1: 0, 2: 1, 3: 11, 4: 157}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!