ID: 1145886296_1145886312

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1145886296 1145886312
Species Human (GRCh38) Human (GRCh38)
Location 17:28384639-28384661 17:28384687-28384709
Sequence CCCCGCCTCGCAATCCCGCGGCG GCCTGTACGCAGCCACCGTTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 60} {0: 1, 1: 0, 2: 0, 3: 2, 4: 24}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!