ID: 1145911724_1145911735

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1145911724 1145911735
Species Human (GRCh38) Human (GRCh38)
Location 17:28547103-28547125 17:28547156-28547178
Sequence CCATGTAGCAGGCCGCATGGGCT CTTCCTCCCAACATTGACTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 90} {0: 1, 1: 0, 2: 0, 3: 21, 4: 286}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!