ID: 1145916465_1145916474

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1145916465 1145916474
Species Human (GRCh38) Human (GRCh38)
Location 17:28576930-28576952 17:28576961-28576983
Sequence CCGGGGGCGTGGCCTGCATGCCC CCACACCCCCTCCCCAGGACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 233} {0: 1, 1: 1, 2: 10, 3: 116, 4: 1132}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!