ID: 1145917500_1145917506

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1145917500 1145917506
Species Human (GRCh38) Human (GRCh38)
Location 17:28584125-28584147 17:28584146-28584168
Sequence CCTTGGCCCAAGCCATATTCCTT TTACCTCCAAGGTCTCTTTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 43, 4: 763} {0: 1, 1: 0, 2: 0, 3: 22, 4: 190}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!