ID: 1145927676_1145927685

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1145927676 1145927685
Species Human (GRCh38) Human (GRCh38)
Location 17:28659743-28659765 17:28659781-28659803
Sequence CCTCATATCCCAGACGGGGCGGC CTCACATCCCAGACGATGGGCGG
Strand - +
Off-target summary {0: 4, 1: 584, 2: 2176, 3: 7760, 4: 9822} {0: 1047, 1: 868, 2: 1428, 3: 496, 4: 262}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!