|
Left Crispr |
Right Crispr |
| Crispr ID |
1145927678 |
1145927686 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:28659751-28659773
|
17:28659786-28659808
|
| Sequence |
CCCAGACGGGGCGGCCAGGCAGA |
ATCCCAGACGATGGGCGGCCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 75, 1: 721, 2: 1943, 3: 4778, 4: 1872} |
{0: 1013, 1: 1801, 2: 978, 3: 377, 4: 250} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|