|
Left Crispr |
Right Crispr |
Crispr ID |
1145927681 |
1145927690 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
17:28659765-28659787
|
17:28659813-28659835
|
Sequence |
CCAGGCAGAGGCGCTCCTCACAT |
GACGCTCCTCACTTCCTAGACGG |
Strand |
- |
+ |
Off-target summary |
{0: 847, 1: 2954, 2: 13133, 3: 7825, 4: 2663} |
{0: 974, 1: 3236, 2: 2980, 3: 3603, 4: 7455} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|