|
Left Crispr |
Right Crispr |
| Crispr ID |
1145927681 |
1145927692 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:28659765-28659787
|
17:28659815-28659837
|
| Sequence |
CCAGGCAGAGGCGCTCCTCACAT |
CGCTCCTCACTTCCTAGACGGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 847, 1: 2954, 2: 13133, 3: 7825, 4: 2663} |
{0: 143, 1: 1989, 2: 4109, 3: 6759, 4: 8758} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|