ID: 1145932202_1145932212

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1145932202 1145932212
Species Human (GRCh38) Human (GRCh38)
Location 17:28693912-28693934 17:28693944-28693966
Sequence CCCCACCAGAAGTTAGGCTCTGT CTGCTGGTGGGAAGTGTTTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 185} {0: 1, 1: 0, 2: 4, 3: 26, 4: 195}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!