ID: 1145939502_1145939509

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1145939502 1145939509
Species Human (GRCh38) Human (GRCh38)
Location 17:28735204-28735226 17:28735225-28735247
Sequence CCCTGCAGGGCTGTGATCCCAGC GCTTCTATCCTGCAGGTGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 92, 4: 481} {0: 1, 1: 0, 2: 1, 3: 18, 4: 163}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!