|
Left Crispr |
Right Crispr |
| Crispr ID |
1145939650 |
1145939654 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:28736077-28736099
|
17:28736116-28736138
|
| Sequence |
CCATCCATGTCCTACAAAGGACA |
TACGGCTGCATAGTTTTCCATGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 12, 2: 35, 3: 63, 4: 241} |
{0: 2, 1: 374, 2: 25580, 3: 13840, 4: 8179} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|