ID: 1145940702_1145940706

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1145940702 1145940706
Species Human (GRCh38) Human (GRCh38)
Location 17:28742010-28742032 17:28742032-28742054
Sequence CCACCCTGATATTGCTTCTCCTC CTGAATGCTCTGAAAAGTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 265} {0: 1, 1: 0, 2: 0, 3: 13, 4: 192}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!