ID: 1145942007_1145942019

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1145942007 1145942019
Species Human (GRCh38) Human (GRCh38)
Location 17:28747517-28747539 17:28747555-28747577
Sequence CCCTTCCGGTGGCAAGCCAGACC GTATCCCTCCACCAGGGGAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 51} {0: 1, 1: 1, 2: 0, 3: 17, 4: 112}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!