ID: 1145959469_1145959477

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1145959469 1145959477
Species Human (GRCh38) Human (GRCh38)
Location 17:28879101-28879123 17:28879122-28879144
Sequence CCTCCACCTTCTGCCTGTGATGG GGAGCCAGGTGTTCCAGGGCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 5, 3: 137, 4: 1323}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!