ID: 1145961027_1145961033

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1145961027 1145961033
Species Human (GRCh38) Human (GRCh38)
Location 17:28886640-28886662 17:28886662-28886684
Sequence CCTGGCCCATCCTGGCTGGGCCT TCCCTAGGCAGTCTGTGTGCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 81, 4: 467} {0: 1, 1: 0, 2: 0, 3: 9, 4: 154}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!