ID: 1145961169_1145961186

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1145961169 1145961186
Species Human (GRCh38) Human (GRCh38)
Location 17:28887305-28887327 17:28887351-28887373
Sequence CCAGCCTAGGGAAATAAAGCCCC CAGGCTAGGGACTAGGGAAGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 9, 4: 130} {0: 1, 1: 1, 2: 0, 3: 39, 4: 342}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!